WormBase Tree Display for RNAi: WBRNAi00114138
expand all nodes | collapse all nodes | view schema
| WBRNAi00114138 | Homol | Homol_homol | D1054:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cagcttcagcggtaataagcctgagacctgtcttgtcgaagcacgaagcgtagatcccagcttcagattctattgatcctggttgaggctttgtttgaattttctggaagcagaaaccagatctccaatcccagaagcacaacgatccgttgtcagcgcctgatacaacaacaccatcatcattggaagacagtgtattgataatagcattatgtccagaaagattctgcataaattctcctttgggaagtttccactgtttgatgttatctggggaagcagaagcaaacatgttgagacgtggatgaattgtcagagctctcactgatttcttgtgatgagttaatgtgcacatagaacgtccagcggccaaatcccatagacgaactgtcgcatcatgagaagcagttattacttgtggatcaactgattgacacacaacatctgcgacggtgtttgtgtgaccagcaaaacaatggacttgagcttttgttctcatatcccaaactctagctgtagaatcacgagcgcaggtgactagaacatcaagagatggatgtactgaaagagcttggacggcacttaaatgcccatgataatgacggatcactttgttgtattccaaatcccagcatttaac | |||
| Experiment | Strain | WBStrain00047118 | |||
| Treatment | Embryonic lethality was scored by imaging a well of 50-100 embryos at 10x magnification. When 20% or more of the embryos exhibited embryonic lethality, the RNAi was scored as embryonic lethal. All other phenotypes scored at 60x magnification during the first 10 hours of embryonic development. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | D1054.15b | Inferred_automatically | RNAi_primary | |
| D1054.15a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00006481 | Inferred_automatically | RNAi_primary | ||
| Transcript | D1054.15a.1 | Inferred_automatically | RNAi_primary | ||
| D1054.15a.2 | Inferred_automatically | RNAi_primary | |||
| D1054.15b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00056424 | ||||
| Phenotype_not_observed (13) | |||||
| Remark | (Table S2) plrg-1 RNAi | ||||
| Method | RNAi |
