WormBase Tree Display for RNAi: WBRNAi00114012
expand all nodes | collapse all nodes | view schema
| WBRNAi00114012 | Homol | Homol_homol | F26D11:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaagcaggagcgtcaatgaaccttatatcagctaaatctctattaattgaattgctagattctccgaatgatgaagttgatgttctgtgatttgaaaccaaagataattgccgtggttgatcaatttcatgaggaagcatatgaccatcaattgatcctttcttatgctttggtgtctttggatgtggtgtattatgccgttcaaagtttccgagatgaatttcagcttctttgttttcttcaaaggtggtatctgcttgatcatggaaatgaactttcggtccaccaagaaatgctcctctatcagtattatgctgtgcacttccacttcgtccttcaccgtcaattgcatcaacttgtggcagtaaatagcacgtgaccaccttgattcctttccgatcatcccgtgtttcagaaagtttcagaattgactgtgtctgattttcactaagccagagagcttgaagcttataaagaacttttacggtgaatggaaggtgaggtaacttgttggacgcaacatccagtacagtcaaattttcgcactttcctattgtcattgggagctcagtgagaatgttctgtcggagggagaggacggttaaagatttacaatttccaat | |||
| Experiment | Strain | WBStrain00047120 | |||
| Treatment | Embryonic lethality was scored by imaging a well of 50-100 embryos at 10x magnification. When 20% or more of the embryos exhibited embryonic lethality, the RNAi was scored as embryonic lethal. All other phenotypes scored at 60x magnification during the first 10 hours of embryonic development. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F26D11.11f | Inferred_automatically | RNAi_primary | |
| F26D11.11c | Inferred_automatically | RNAi_primary | |||
| F26D11.11e | Inferred_automatically | RNAi_primary | |||
| F26D11.11d | Inferred_automatically | RNAi_primary | |||
| F26D11.11a | Inferred_automatically | RNAi_primary | |||
| F26D11.11b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002632 | Inferred_automatically | RNAi_primary | ||
| Transcript | F26D11.11b.1 | Inferred_automatically | RNAi_primary | ||
| F26D11.11f.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11e.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11c.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11d.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00056424 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | 1.5 Fold arrest | ||
| WBPhenotype:0000368 | Remark | 1.5 Fold arrest | |||
| Remark | (Table S2) let-413 RNAi | ||||
| Method | RNAi |
