WormBase Tree Display for RNAi: WBRNAi00110364

WBRNAi00110364 Homol: Homol_homol: F46E10:RNAi
  Sequence_info: DNA_text: ATGTCACAAGTGGCCGCAATGGACCTTCGTGTACTTACACAGTTCGACATCGCCAGTTTGGAAGAGGACCGCAAAAAGATGTTGTACGAGGAGCCGATCTCTTTGGAAGAAGCCGCTCTGAACGCCAACGACGTGATGGTGGCGCCGAGTCGAAAGTCGTATGTGCACGGCTGTTCGACTGTTCCTTTGCTTTTTGAAACTGTTGGAGATCGACTTCGATCAGCAGTTGACCAGGTTCCAGATAAGGAATTTTTGATTTTCAAAAGAGAAGGAATCAGGAAAACTTATTCGCAAGTCGCCACAGATGCAGAAAACCTGGCTTGCGGGCTCCTCCACTTGGGTTTGAAAAAAGGAGATCGTATTGGAATTTGGGGGCCAAACACATACGAGTGGACCACAACACAGTTTGCCAGTGCTCTTGCCGGAATGGTTCTAGTCAACATAAACCCATCATATCAATCAGAAGAACTTCGCTATGCTATTGAAAAAGTAGGAATCAGAGCCCTTATCACACCACCTGGATTCAAGAAGTCAAATTATTATCAGAGCATCAAGGATATTCTGCCAGAAGTTACATTGAAAGAACCGGGAAAGAGTGGAATCACATCGAGAAATTTCACATGTTTCCAACACTTGATCATGTTTGACGAGGAAGATAAGATCTATCCAGGAGCCTGGAAATACACAGATGTAATGAAAATGGGAACAGAAGAAGACAGACACCACCTCTCAAAGATCGAGAGGGAAACTCAACCAGATGACTCACTGAACATTCAATACACAAGTGGAACAACTGGACAGCCTAAAGGAGCAACTCTCACTCATCACAATGTTCTCAATAATGCATTTTTTGTTGGTCTCCGTGCTGGATATAGTGAAAAGAAGACAATTATCTGCATTCCAAATCCACTTTATCACTGTTTTGGATGTGTCATGGGAGTTCTCGCCGCACTCACACACCTTCAAACTTGCGTATTCCCTGCTCCATCATTCGATGCTCTCGCTGCTCTTCAAGCTATTCACGAGGAAAAATGCACAGCTCTTTATGGAACACCAACAATGTTTATTGATATGATTAATCATCCCGAGTATGCAAACTATAACTATGATTCAATTAGAAGTGGATTCATTGCTGGAGCTCCGTGTCCGATAACACTTTGCCGCCGGTTAGTACAAGATATGCATATGACTGACATGCAAGTATGCTATGGAACTACTGAAACATCTCCAGTATCTTTTATGTCAACACGTGATGATCCACCAGAGCAAAGGATCAAATCAGTCGGACATATTATGGATCACTTGGAAGCTGCAATTGTAGACAAGAGAAACTGCATTGTTCCACGTGGCGTAAAAGGAGAAGTTATTGTCCGTGGATACTCAGTTATGCGGTGCTATTGGAACAGTGAAGAGCAGACAAAGAAGGAAATCACTCAAGACAGATGGTATCATACTGGAGATATTGCTGTTATGCATGATAATGGAACCATCTCTATTGTTGGAAGATCGAAAGATATGATTGTTCGTGGAGGAGAGAATATTTATCCTACCGAAGTAGAACAATTTTTATTCAAGCATCAGTCAGTAGAAGATGTTCATATTGTCGGAGTACCAGATGAACGATTCGGTGAGGTGGTCTGCGCCTGGGTCAGATTGCACGAAAGCGCTGAAGGAAAAACGACTGAAGAGGATATTAAGGCTTGGTGCAAGGGAAAAATTGCTCATTTCAAAATTCCTCGCTACATCCTCTTCAAAAAGGAGTACGAATTCCCGCTGACAGTGACTGGAAAAGTGAAAAAGTTTGAAATCCGCGAAATGTCAAAGATTGAACTGGGTCTCCAGCAAGTCGTCTCTCATTTCTCCGAGCTTTAA
  Experiment: Genotype: lim-7p:acs-1(hairpinRNAi)
    Delivered_by: Transgene_expression
  Inhibits: Predicted_gene: F46E10.1c Inferred_automatically: RNAi_primary
      F46E10.1a Inferred_automatically: RNAi_primary
      F46E10.1b Inferred_automatically: RNAi_primary
    Gene: WBGene00018488 Inferred_automatically: RNAi_primary
    Transcript: F46E10.1c.1 Inferred_automatically: RNAi_primary
      F46E10.1b.1 Inferred_automatically: RNAi_primary
      F46E10.1a.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00040893
  Phenotype: WBPhenotype:0000050 Remark: "In contrast, when acs-1 expression was inhibited in the somatic gonad by somatic gonad-specific RNAi, the remaining expression of acs-1 in the intestine, neurons, and possibly other tissues was insufficient to prevent the Emb phenotype (Materials and Methods; Supplemental Fig. S2ad-ag)." Figure caption: "DIC images illustrating the gonadal and embryonic phenotype in lim-7Prom:acs-1(hpRNAi) animals. Most of the affected animals had prominent gonadal defects and were sterile (ad, ae). Image (af) shows the Emb phenotype of the affected animals, which is similar to those observed in the acs-1(RNAi)C17ISO embryos (Figure 3I)."
    WBPhenotype:0000688 Remark: "In contrast, when acs-1 expression was inhibited in the somatic gonad by somatic gonad-specific RNAi, the remaining expression of acs-1 in the intestine, neurons, and possibly other tissues was insufficient to prevent the Emb phenotype (Materials and Methods; Supplemental Fig. S2ad-ag)." Figure caption: "DIC images illustrating the gonadal and embryonic phenotype in lim-7Prom:acs-1(hpRNAi) animals. Most of the affected animals had prominent gonadal defects and were sterile (ad, ae). Image (af) shows the Emb phenotype of the affected animals, which is similar to those observed in the acs-1(RNAi)C17ISO embryos (Figure 3I)."
    WBPhenotype:0000691 Remark: "In contrast, when acs-1 expression was inhibited in the somatic gonad by somatic gonad-specific RNAi, the remaining expression of acs-1 in the intestine, neurons, and possibly other tissues was insufficient to prevent the Emb phenotype (Materials and Methods; Supplemental Fig. S2ad-ag)." Figure caption: "DIC images illustrating the gonadal and embryonic phenotype in lim-7Prom:acs-1(hpRNAi) animals. Most of the affected animals had prominent gonadal defects and were sterile (ad, ae). Image (af) shows the Emb phenotype of the affected animals, which is similar to those observed in the acs-1(RNAi)C17ISO embryos (Figure 3I)."
  Remark: (Supplemental Fig. S2ad-ag) somatic gonad-specific acs-1 (hairpin) RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation.
  Method: RNAi