WormBase Tree Display for RNAi: WBRNAi00098864
expand all nodes | collapse all nodes | view schema
| WBRNAi00098864 | Homol | Homol_homol | C32D5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGAAGTGGGCTTACAAGGAGGAGAACAACTTTGAGAAGCGTCGTGCCGAAGGAGACAAGATCCGCAGAAAGTACCCAGACCGTATTCCAGTGATTGTTGAGAAAGCACCAAAGTCAAAGCTCCATGACTTGGATAAGAAGAAGTACTTGGTCCCATCCGATCTTACTGTTGGACAGTTCTACTTCCTCATCAGAAAACGCATCCAACTTCGTCCAGAAGATGCTCTGTTCTTCTTTGTCAACAATGTCATTCCACAAACCATGACCACAATGGGACAACTCTACCAGGACCATCACGAGGAAGACTTGTTCCTTTACATCGCCTACAGTGACGAAAGTGTGTATGGAGGAGAGGTCGAAAAGAAGGAATAA | |||
| Experiment | Laboratory | HZ | |||
| Date | 01 Jul 2010 00:00:00 | ||||
| Genotype | lit-1::gfp | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C32D5.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002980 | Inferred_automatically | RNAi_primary | ||
| Transcript | C32D5.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00036466 | ||||
| Phenotype_not_observed | WBPhenotype:0000306 | Remark | RNAi inactivation of the autophagy gene lgg-1 has no effect on the periodic expression of LIT-1 (data not shown). | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
