WormBase Tree Display for RNAi: WBRNAi00092241
expand all nodes | collapse all nodes | view schema
| WBRNAi00092241 | Homol | Homol_homol | T08A9:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGAAAACTTATATCCTTCTTGCCGCCGTTACTCTTGCCGTTTTTTTCTCATCGACAGAGGCTAATGGAATTGAATGTGAGATGTGCAAGATGTCTGTCAAGATTGTTGTTCCAATGCTTGGAGAAGACACTGAATCAATTAAGAAGGCCGTCGACGCTGAATGCAAGAAGGAATTCCACAGCATTCCATTCGGAACTCAAGAGTGCAAAAAGTTCATTGACACCAAGCTCGACCCAATCATTCACGAACTCGAGAACGGAACTGCTCCATCTGACGTCTGCACCAAGCTTGGAATGTGTTAA | |||
| Experiment | Date | 30 May 2012 00:00:00 | |||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | T08A9.7 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004988 | Inferred_automatically | RNAi_primary | ||
| Transcript | T08A9.7.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00041167 | ||||
| Phenotype | WBPhenotype:0000640 | Remark | Increased number of eggs laid. | ||
| Phenotype_not_observed | WBPhenotype:0000710 | Remark | Has same amount of bacteria surviving in the intestine as wildtype. | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
