WormBase Tree Display for RNAi: WBRNAi00087466
expand all nodes | collapse all nodes | view schema
| WBRNAi00087466 | Homol | Homol_homol | Y43C5A:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgggacaatcttggggatatgaagggattgcgaaacgttcactatgtacacataaatggctatataatttgaatttgcattcaataaatcttttccttccaattgagtcaaaaatgtcagctcaagcaagtcgtcaaaagaaatcggatcaagagcagcgtgcagctgatcaagctttgctcaatgcagcaatcgaggataatgcgatggagcaagatgaaaacttcacagttatcgataaacttgagtcttcaggaatcagttctggcgatatttcaaaactaaaagaagctggatactatacatacgaatcgctggcatttactacaagacgcgaactccgaaatgtcaaaggaattagtgatcagaaagctgaaaagataatgaaagaagccatgaaattcgtgcagatgggattcacgacgggagccgaggttcatgtgaagcgaagccagctggtgcagatcagaactggatctgcttcacttgacagactgttgggtggcggtatcgaaacaggcagtatcactgaggtttacggagaatatagaacaggaaaaactcagctttgccacagtctggcagtcttgtgtcaattgccgattgatatgggaggtggtgagggaaaatgtatgtatattgataccaatgccacttttcgacccgaacgaattattgctatcgctcagagatacaatatggacagtgctcatgtactcgagaatatcgctgttgcacgtgcatacaactcagaacatttgatggctttgattattcgagcaggagcaatgatgtccgagagtcgttatgctgttgtgattgttgactgtgcaactgctcatttccgtaacgaatacactggaagaggagatctagcggaacgtcagatgaagctctctgcttttctgaaatgccttgccaagcttgccgatgaatatggtgtcgctgtaattattaccaatcaagttgtagcacaagtcgacggaggagcctcgatgttccaggctgatgctaaaaagcccattggaggtcacatcatcgctcacatgtctactaccagattgtaccttcgaaaaggaaaaggagagaatcgcgtcgcaaaaatggttcaatcacccaatttaccagaagccgaagcgacctactcaatcacgaatcatggtattgaggacgcacgcgaggactag | |||
| Experiment | Date | 31 Dec 1998 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y43C5A.6b | Inferred_automatically | RNAi_primary | |
| Y43C5A.6a | Inferred_automatically | RNAi_primary | |||
| Y43C5A.6c | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004297 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y43C5A.6c.1 | Inferred_automatically | RNAi_primary | ||
| Y43C5A.6a.1 | Inferred_automatically | RNAi_primary | |||
| Y43C5A.6b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00003358 | ||||
| Phenotype | WBPhenotype:0000154 | Remark | Each worm laid about 50 to 100 eggs during its reproductive life span, while uninjected hermaphrodite that has not mated normally lays about 300 eggs. About 20% of the eggs developed to adult stage (F1 progeny), and 80% died during early embryogenesis. The number of eggs laid by each F1 progeny was as low as 20 - 50 eggs. Most eggs were variable in shape, and their proliferation was arrested in early stages. Some eggs did not have a hard shell and hence were probably unfertilized. These results suggest that the F1 progenies that grew to adults escaped the effect of RNAi by using the CeRDH1 protein synthesized before the dsRNA injection. If this is the case, then it is not surprising that all the F2 eggs died, because the F1 escapers could not synthesize CeRDH1 protein due to RNAi. This phenotype was equally observed in worms injected into either the gonads or the intestinal cytoplasms. The chromosome structure and The shape of some oocytes of both I0 and F1 were irregular and variable compared with oocytes of control hermaphrodite. The variability in the roundness of the eggs that died in the early stages due to RNAi with Ce-rdh-1 may be a result of the heterogeneous shape of oocytes in gonads. Moreover, the chromosome structure of oocytes was drastically changed in F1 escapers. On the other hand, no significant difference in chromosome structure was observed between the F1 and control worms during mitosis or in the early prophase of meiosis I. In all the oocytes of F1 escapers, the chromosome condensation of six bivalents and the dissociation of chiasmata were blocked. Meiosis in normal oocytes pauses in the diakinesis stage and the six condensed bivalents are visualized and counted. The oocyte nuclei do not go on to complete meiotic divisions I and II until ovulation and fertilization have occurred. These results indicate that oogenesis in the F1 escapers could not enter the diakinesis stage. | ||
| WBPhenotype:0000373 | |||||
| WBPhenotype:0001100 | |||||
| WBPhenotype:0001362 | |||||
| WBPhenotype:0001836 | |||||
| WBPhenotype:0001898 | |||||
| Remark | paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. CDNA clone yk401c3 was used as template for dsRNA. | ||||
| Method | RNAi |
