WormBase Tree Display for RNAi: WBRNAi00086780
expand all nodes | collapse all nodes | view schema
| WBRNAi00086780 | Homol | Homol_homol | CHROMOSOME_I:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggctgatcaaaagaaagtatccgaggcggcaaaggaacgcgaaatcaagatatcgtcttcggataacgaaatcttcttggtcccacgcaatgtgatccgtctctcaaacactatcaacactctcctgatggatcttggactcgacgacgaagaaggaaccaacgctgagccaattccagttcaaaacgtcactgcctcgattctgaagaaggtcattagttggtgcaaccatcatcactccgatcctatctcgactgaagattccgataaccgcgagaaaagaactgacgacataggcagctgggacgtcgagtttcttaaggttgaccaaggaacccttttcgagctcatcttggctgccaactatttggacatcaagggacttcttgatgttacctgcaagactgttgctaacatgatcaagggaaaatctccagaagagattcgtcgcactttcaacatcaagaacgacttcaccccggaagaggaagagcaaatccgcaaagagaatgcctggtgcgaggattaa | |||
| Experiment | Laboratory | ET | |||
| Date | 19 Feb 2002 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F46A9.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004807 | Inferred_automatically | RNAi_primary | ||
| Transcript | F46A9.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005129 | ||||
| Phenotype | WBPhenotype:0000172 | Remark | hyperplasia; early embryo spindle mispositioning, ectopic blebbing, abnormal polar bodies; pachytene arrest; and univalent diakinetic chromosomes | ||
| WBPhenotype:0000762 | |||||
| WBPhenotype:0001080 | |||||
| WBPhenotype:0001147 | |||||
| WBPhenotype:0001946 | |||||
| WBPhenotype:0002013 | |||||
| Remark | paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
