WormBase Tree Display for RNAi: WBRNAi00086034
expand all nodes | collapse all nodes | view schema
WBRNAi00086034 | Homol | Homol_homol | C15F1:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgtttatgaatcttctcactcaggtctccaacgcgatttttccgcaggtcgaagccgctcaaaaaatgtcgaaccgtgctgtcgctgttcttcgtggagaaactgttaccggtactatctggatcacacagaagtccgaaaatgaccaggcagttattgaaggagaaatcaagggacttactcccggtcttcatggattccacgttcaccaatatggtgattccaccaacggatgcatttctgccggtccacacttcaatccatttggaaagactcatggtggaccaaaatccgagatccgtcacgtaggcgatctaggaaatgtggaagctggagccgatggagtggcaaaaatcaagctcaccgacacgctcgtcacgctttacggtccaaacactgtcgttggccgatctatggttgttcatgccggacaagacgacctcggcgagggagtcggagacaaggcagaagagtccaagaagactggaaacgccggagctcgtgctgcctgcggtgtcattgctctcgctgctccccagtga | |||
Experiment | Laboratory | MQ | |||
Date | 27 Oct 2010 00:00:00 | ||||
Genotype | nuo-6(qm200) | ||||
Inhibits | Predicted_gene | C15F1.7b | Inferred_automatically | RNAi_primary | |
C15F1.7a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004930 | Inferred_automatically | RNAi_primary | ||
Transcript | C15F1.7b.1 | Inferred_automatically | RNAi_primary | ||
C15F1.7a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000500574 | ||||
Reference | WBPaper00037874 | ||||
Phenotype | WBPhenotype:0000039 | Remark | sod-1 RNAi slightly increases the long lifespan of nuo-6(qm200) mutants. | ||
Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation (C15F1.7a). | ||||
Method | RNAi |