WormBase Tree Display for RNAi: WBRNAi00085025
expand all nodes | collapse all nodes | view schema
| WBRNAi00085025 | Homol | Homol_homol | K08H10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | agcttccgacagtacgaaatccctcactagtgacgctggagatgcaattttgggtgcctatgatgctgccaaagaaaaggcttccgatgcatgggagtcaactaaggaaatggtttctgaagcatatgaacaagctgagaaacacgctgatgatggcgctgattctgctaaggactacgtcgaagatgcaaaagacaaagcttccgatgtctgggattctgcaaaggataaaacgtctgatgttttcgactctttaaaggaacacggtgaagatgcttctgatagtgccaaggacctcgcaaatgacgcagaagacgcaatcaaagatacttatgattcggccaaagaaaaagcttccgatgctttcgattctgcaaaggaacatggtgaagatgcgcaagaatctgccaaagaatatttcgaacaggctaaggaaaaagcttctgacgcactcgactctgctcagaaacac | |||
| Experiment | Date | 24 Sep 2004 00:00:00 | |||
| Treatment | L1 worms were placed at 35C for 3, 6 or 8h,on NGM plates. Heat-stressed cultures were returned to 22 C to allow recovery and the worms were scored for survival. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene (14) | ||||
| Gene | WBGene00002263 | Inferred_automatically | RNAi_primary | ||
| Transcript (14) | |||||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024566 | ||||
| Phenotype | WBPhenotype:0001090 | ||||
| Method | RNAi |
