WormBase Tree Display for RNAi: WBRNAi00083298
expand all nodes | collapse all nodes | view schema
WBRNAi00083298 | Homol | Homol_homol | Y71F9AL:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | cagaaccgctttccacgctgaagccgaagatcatgagcagctagaaaatgcgaaccgccgacaagccgaaaaggagagattccgccaaatttggcatctatttctgacgcatttggagcaagatccacggaaaactggaagtttctggctgcaagagctgcctgtgttgctccgcgaggtttcgagtttcgatgaggatattttgggattcggagcgcttgatggtgaggagcaattcgatttttttgcagttgcaggagaagccgaagtagacgggaacaagtatccatcattgtcgggaatgtgtaaattgtcgtttttcattatatttttcatgtttttgctggtattaatttg | ||||
Experiment | Laboratory | YM | ||||
Date | 08 Jan 2003 00:00:00 | |||||
Genotype | AJM-1::GFP | |||||
Treatment | L4 larvae were washed with M9 several times and placed on an NGM plate without OP50 for 1 hour. Five worms were selected and immersed in RNA solution for 24 hours and then allowed to recover by incubation at 20C on NGM plates for 36 hours before observation. | |||||
Delivered_by | Soaking | |||||
Inhibits (3) | ||||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00005843 | |||||
Phenotype | WBPhenotype:0000703 | EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |
WBPhenotype:0001908 | Remark | Hypodermal cells of the developing embryo failed to migrate properly toward the ventral midline, thus resulting in a ventral enclosure defect | ||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
Remark | Authors report that clone yk170f5 was used to target arx-1 for knockdown, which maps to an intron of the arx-1 gene and an exon of the gene Y71F9AL.6; results should be interpreted with caution | |||||
Method | RNAi |