WormBase Tree Display for RNAi: WBRNAi00082132
expand all nodes | collapse all nodes | view schema
WBRNAi00082132 | Homol | Homol_homol | Y43C5A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ggaggtggtgagggaaaatgtatgtatattgataccaatgccacttttcgacccgaacgaattattgctatcgctcagagatacaatatggacagtgctcatgtactcgagaatatcgctgttgcacgtgcatacaactcagaacatttgatggctttgattattcgagcaggagcaatgatgtccgagagtcgttatgctgttgtgattgttgactgtgcaactgctcatttccgtaacgaatacactggaagaggagatctagcggaacgtcagatgaagctctctgcttttctgaaatgccttgccaagcttgccgatgaatatggtgtcgctgtaattattaccaatcaagttgtagcacaagtcgacggaggagcctcgatgttccaggctgatgctaaaaagcccattggaggtcacatcatcg | |||
Experiment | Date | 26 Nov 2001 00:00:00 | |||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | Y43C5A.6b | Inferred_automatically | RNAi_primary | |
Y43C5A.6a | Inferred_automatically | RNAi_primary | |||
Y43C5A.6c | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004297 | Inferred_automatically | RNAi_primary | ||
Transcript | Y43C5A.6c.1 | Inferred_automatically | RNAi_primary | ||
Y43C5A.6a.1 | Inferred_automatically | RNAi_primary | |||
Y43C5A.6b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005134 | ||||
Phenotype | WBPhenotype:0000775 | Remark | Highly unshaped and poorly condensed meiotic chromosomes, often grouped in bunches, are observed in all the oocytes of rad-51 RNAi worms. | ||
WBPhenotype:0001348 | Remark | Highly unshaped and poorly condensed meiotic chromosomes, often grouped in bunches, are observed in all the oocytes of rad-51 RNAi worms. | |||
Method | RNAi |