WormBase Tree Display for RNAi: WBRNAi00080212
expand all nodes | collapse all nodes | view schema
WBRNAi00080212 | Homol | Homol_homol | R07G3:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gatcaagtgcgtcgtcgttggagatggagctgtcggtaaaacttgtctcctgatcagctataccacaaacaagtttccttctgagtatgtgccgacagtcttcgacaattacgccgtcacagtaatgatcggtggcgagccatacacattaggattgtttgatactgctggacaggaagattacgatcgattaaggcctctatcgtatccacagaccgacgtgtttcttgtttgcttctccgtggttgctccagcttcattcgagaatgtccgagaaaaatgggtgcctgaaatttcgcatcattgctcaaagaccccattcttgttagttggtactcaagtcgatctcagggatgatccaggaatgctcgagaaactggcaaaaaacaagcagaaaccagtgtcaacggatgttggagagaagttggcaaaggaattgaaagcagtgaaatacgttgaatgctcagcgttgacgcagaagggactgaaaaatgtattcgacgaagccattctggccgctctcgacccaccacaacaggagaagaagaagaagtgcaatattctc | |||
Experiment | Laboratory | OD | |||
Date | 24 Oct 2008 00:00:00 | ||||
Treatment | After injection, worms were allowed to recover for 44-50 hrs at 16C prior to filming | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | R07G3.1 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00000390 | Inferred_automatically | RNAi_primary | ||
Transcript | R07G3.1.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00032405 | ||||
Phenotype_not_observed | WBPhenotype:0001129 | Remark | RNAi of cdc-42 does not affect the cleavage furrow or cytokinesis | ||
Method | RNAi |