WormBase Tree Display for RNAi: WBRNAi00079862
expand all nodes | collapse all nodes | view schema
| WBRNAi00079862 | Homol | Homol_homol | C32D5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | agaaaacatgattttctgggaggggagaagagcaacttcgtagacaatagtttgaatagaagtcactactcggaaccgtcatacgagaaaaatgagaagaaaatgtgaaggaaatacagaattattacagaaaatgagaagatttttttaaaggggctttgggtttccattagaagtatgaaatttccattgtacaagtatacacattcgtcggcggataatacatgacactttattccttcttttcgacctctcctccatacacactttcgtcactgtaggcgatgtaaaggaacaagtcttcctcgtgatggtcctgtaataaagaaaagggttaattaaatgaaaataaacgactggttagttacctggtagagttgtcccattgtggtcatggtttgtggaatgacattgttgacaaagaagaacagagcatcttctggacgaagttggatgcgttttctgatgaggaagtagaactgtccaacagtaagatcggatgggaccaagtacttcttcttatccaagtcatggagctttgactttggtgctttctcaacaatcactggaatacggtctgggtactttctgcggatcttgtctccttcggcacgacgcttctcaaagttgttctcctccttgtaagcccacttcattttgattcgaaggttagtgtgaa | |||
| Experiment | Date | 28 Jul 2003 00:00:00 | |||
| Genotype | daf-2(e1370) | ||||
| Temperature | 25 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C32D5.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002980 | Inferred_automatically | RNAi_primary | ||
| Transcript | C32D5.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006070 | ||||
| Phenotype | WBPhenotype:0000308 | Remark | Knocked down gene not required for dauer initiation but is required for normal dauer morphogenesis in daf-2(e1370) mutant animals. | ||
| WBPhenotype:0001545 | Remark | Animals formed abnormal dauers. Like the daf-2(e1370) dauers, these animals underwent a developmental arrest in the L3 gonadal stage and had some hyperpigmented granules in the intestine, some increased fat storage, and some radial constriction and elongation of the body and pharynx. However, the hyperpigmented granules were unevenly distributed and the magnitudes of fat storage, radial constriction, and elongation of the body and pharynx were less than that observed in untreated daf-2(e1370) animals. Furthermore, animals failed to form dauer alae, were not resistant to SDS, died within a few days at 25C, and usually did not resume reproductive growth on transfer to 15C. | |||
| Method | RNAi |
