WormBase Tree Display for RNAi: WBRNAi00079161
expand all nodes | collapse all nodes | view schema
| WBRNAi00079161 | Homol | Homol_homol | Y51H7C:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | cattgaaattccgccaaaagctctcggaaatcgcgattttctcaatttgacctacgcggcgaagcggggacatttcgcgtgccacgtggcgcggcttctgagcggaaaattcgaaaaagtcgagttcacagccggtggagcccacagagatgacccaattttcgcggatattcttgtcgatggagttcgaattggat | ||||
| Experiment | Laboratory | AY | ||||
| Date | 20 Aug 2009 00:00:00 | |||||
| Genotype | nol-6(ac1) | |||||
| Treatment | Synchronized L1s grown on RNAi food for 4 days at 20C to gravid adult stage before being transferred to S. enterica strain SL1344 for 70 hours at 25C | |||||
| Temperature | 25 | |||||
| Delivered_by | Bacterial_feeding | |||||
| Inhibits | Predicted_gene | Y51H7C.11 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00021789 | Inferred_automatically | RNAi_primary | |||
| Transcript | Y51H7C.11.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00035215 | |||||
| Phenotype | WBPhenotype:0001819 | Remark | reduced colony forming units of S. enterica from RNAi worms compared to controls | |||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | |||
| Method | RNAi |
