WormBase Tree Display for RNAi: WBRNAi00078433
expand all nodes | collapse all nodes | view schema
| WBRNAi00078433 | Homol | Homol_homol | C38C10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ggagcatccacccacgtcgaaatgctgtgttcaactatctctcacttataacaacacatcgaccaagaagctggcgccggcgacgaaagtggatcaaccattgcagaatattattttcaatgtatggaagactgttattttcttgcctggctctcttcaaaaaattcaaattttcaggttatcgtcagtcaaagtcgtacttcagaatcatttagtgttcttcgatttatctatagaattaaagagtaagttcttgtactttaaagtggagctgcgagtgaattttgcttcaaaattaccaaaatagcagggggaaaaatcgaaaatgaataataatccaacttctaaagagaattttcaatttttccaaatttccacttttgaattcgttccaaactgaaaacggaaagaccaatcagcgatctgccccgcctacttacaccgtctgattggttgaagaatgggcggagcgaatcgctgattgatattgcagttctcattttgttcagacagagagagctttctcgattttctttttgttgctttgtggtatttctgaatttcagattattttggatattttaacgcaaaatcaccattcaataaatttactttttcaaaggacctcccatttttaattaaatcaaatttcagaaactttgtggttgttccatcagctaatgaaaagaacaaacaaatggcagatgaagtaaacgctgaaacaaagacttctgggggaaatccaatttggaatctggtgcgtctcgttatggatcgattcaactcgggcgactggaatcctggaaaccgaga | |||
| Experiment | Laboratory | LD | |||
| Date | 20 Jun 2002 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C38C10.5a | Inferred_automatically | RNAi_primary | |
| C38C10.5b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004343 | Inferred_automatically | RNAi_primary | ||
| Transcript | C38C10.5a.1 | Inferred_automatically | RNAi_primary | ||
| C38C10.5b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005433 | ||||
| Phenotype | WBPhenotype:0000113 | Remark | RGR-1 is required broadly for early embryonic transcription. Authors used various transgenes to show this. They also showed that maternal PIE-1::GFP expression and localization patterns appeared normal at every stage, therefore RGR-1 does not detectably affect maternal mRNA stores but may broadly impair new mRNA transcription. | ||
| WBPhenotype:0000354 | Remark | Embryos arrest development after forming approximately100 cells that lack any signs of differentiation. | |||
| WBPhenotype:0000867 | Remark | Embryos arrest development after forming approximately100 cells that lack any signs of differentiation. | |||
| WBPhenotype:0001351 | Remark | Phosphorylation of Pol II CTD Ser-2 and Ser-5 is undetectable. Rgr-1 plays a generally critical role early during the transcription cycle prior to phosphorylation of the Pol II CTD. | |||
| Method | RNAi |
