WormBase Tree Display for RNAi: WBRNAi00077995
expand all nodes | collapse all nodes | view schema
| WBRNAi00077995 | Homol | Homol_homol | F53F10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | catatgcctaccttttcaagtacattatcatcggggatactggagtaggaaaatcctgcttgctccttcagtttaccgacaaacgtttccagccagttcatgatttgacgattggcgtcgaattcggagcccgtatggtgacaattgacggaaagcagatcaaacttcaaatttgggacacagccggacaagaatcattccgctccatcactcgttcctattatcgtggagccgccggagctcttctcgtctacgacattacacgacgcgacacattcaatcatttgacatcttggcttgaggatgccaggcagcacagtaattccaatatggttattatgttgattggaaataagagtgacctggaagcccgtcgcgaagtgaaacgtgaagagggagaagcattcgcacgagagcacggactcgtattcatggagacatctgccaagacggctgccaacgtggaagaggcgttcatcgacactgccaaagagatctaccgtaagattcaagaaggcgtgttcgacattaacaatgaggcaaacggaatcaagttgggaccacagcactctccaagctcaccaaattctccagg | |||
| Experiment | Laboratory | XW | |||
| Date | 18 Jan 2008 00:00:00 | ||||
| Treatment | Texas Red-conjugated BSA was injected at 1 mg/ml into the body cavity in the pharyngeal region and endosomal transport was examined in pulse-chase experiments after RNAi treatment. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F53F10.4b | Inferred_automatically | RNAi_primary | |
| F53F10.4c | Inferred_automatically | RNAi_primary | |||
| F53F10.4d | Inferred_automatically | RNAi_primary | |||
| F53F10.4a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00006833 | Inferred_automatically | RNAi_primary | ||
| Transcript | F53F10.4d.1 | Inferred_automatically | RNAi_primary | ||
| F53F10.4b.1 | Inferred_automatically | RNAi_primary | |||
| F53F10.4c.1 | Inferred_automatically | RNAi_primary | |||
| F53F10.4a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031498 | ||||
| Phenotype | WBPhenotype:0001754 | Remark | Authors found that most Texas Red-conjugated BSA was trapped within the endosomes for up to 12 hours after injection, whereas in the wild-type coelomocytes it was transported to lysosome within 15 to 30 minutes post-injection. | ||
| Method | RNAi |
