WormBase Tree Display for RNAi: WBRNAi00077989
expand all nodes | collapse all nodes | view schema
WBRNAi00077989 | Homol | Homol_homol | F53F10:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | catatgcctaccttttcaagtacattatcatcggggatactggagtaggaaaatcctgcttgctccttcagtttaccgacaaacgtttccagccagttcatgatttgacgattggcgtcgaattcggagcccgtatggtgacaattgacggaaagcagatcaaacttcaaatttgggacacagccggacaagaatcattccgctccatcactcgttcctattatcgtggagccgccggagctcttctcgtctacgacattacacgacgcgacacattcaatcatttgacatcttggcttgaggatgccaggcagcacagtaattccaatatggttattatgttgattggaaataagagtgacctggaagcccgtcgcgaagtgaaacgtgaagagggagaagcattcgcacgagagcacggactcgtattcatggagacatctgccaagacggctgccaacgtggaagaggcgttcatcgacactgccaaagagatctaccgtaagattcaagaaggcgtgttcgacattaacaatgaggcaaacggaatcaagttgggaccacagcactctccaagctcaccaaattctccagg | |||
Experiment | Laboratory | XW | |||
Date | 18 Jan 2008 00:00:00 | ||||
Treatment | Embryos laid between 36 and 48 hours post-injection were used for analyzing the somatic cell corpse phenotype. | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | F53F10.4b | Inferred_automatically | RNAi_primary | |
F53F10.4c | Inferred_automatically | RNAi_primary | |||
F53F10.4d | Inferred_automatically | RNAi_primary | |||
F53F10.4a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00006833 | Inferred_automatically | RNAi_primary | ||
Transcript | F53F10.4d.1 | Inferred_automatically | RNAi_primary | ||
F53F10.4b.1 | Inferred_automatically | RNAi_primary | |||
F53F10.4c.1 | Inferred_automatically | RNAi_primary | |||
F53F10.4a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00031498 | ||||
Phenotype | WBPhenotype:0001181 | ||||
Method | RNAi |