WormBase Tree Display for RNAi: WBRNAi00075712
expand all nodes | collapse all nodes | view schema
| WBRNAi00075712 | Homol | Homol_homol | Y71F9B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaccagcaattgagccaacacaattggtatacacacgggaaaacgatgaagaatttcaaggatctttactatcaagttttggagaagtcgatgattattatgtaaaaacctcaacaatcggaagaactcgaccacagcctcgcccgaagcgtgagccgaatcagctgacaagtatggatatgatgtctgcagaacttgacaaaagccgtcacaccatggaaggatcaatgcgtgatgctcaaacatcaagcttcctcgacgcggcccgtgtccgaatgaaacaatccattggtgcagctcacgctgttggacttgcaagccatcagccaccagcttctccagtcgcagcagcagcagcagctccaggcggtccgatgaggcataattcatatccgagtggctttgaaccgccgccgtcggtggctccgtatgatttccctgctgatccatcaaagaagcagcggaaacagcgtgccaagaagcagcctggagaagagccgccggctggaaggggtaaaggagggaagaagggacgaggagctggagcagttggagcagcagcggctggtggaaggaaaagtgctggtggagctggagaaaatccgtttgggatggatccgatgaggcctccgatgttgcagaggagctcgagtgaacagc | |||
| Experiment | Laboratory | EM | |||
| Date | 15 Dec 2000 00:00:00 | ||||
| Genotype | egl-5::gfp; him-5(e1490) | ||||
| Temperature | 20 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y71F9B.10c | Inferred_automatically | RNAi_primary | |
| Y71F9B.10b | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10d | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10g | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10e | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004946 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y71F9B.10g.1 | Inferred_automatically | RNAi_primary | ||
| Y71F9B.10d.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10c.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10e.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10b.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000501691 | ||||
| Reference | WBPaper00004616 | ||||
| Phenotype | WBPhenotype:0001276 | Remark | In the male tail egl-5 expression is observed, not only in the R4-R6 daughters,but also in additional cells. | ||
| Method | RNAi |
