WormBase Tree Display for RNAi: WBRNAi00075651
expand all nodes | collapse all nodes | view schema
WBRNAi00075651 | Homol | Homol_homol | C35C5:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | cctacccacagacggatgttttcattctctgcttctctgtcgtctcgcccgtatcgtttgacaatgtggcaagcaagtggattccggaaatacgacagcattgtccagatgcgcctgtcattctagttggtaccaaactcgatttgcgcgacgaggccgaaccgatgcgtgctctgcaggccgaaggaaagtccccaatttccaaaacgcaaggcatgaaaatggctcaaaaaattaaagctgtcaagtatttggaatgctctgcattgac | ||||
Experiment | Laboratory | JE | ||||
Date | 21 May 2007 00:00:00 | |||||
Strain | WBStrain00004472 | |||||
Delivered_by | Bacterial_feeding | |||||
Inhibits | Predicted_gene | C35C5.4b | Inferred_automatically | RNAi_primary | ||
C35C5.4a | Inferred_automatically | RNAi_primary | ||||
Gene | WBGene00003239 | Inferred_automatically | RNAi_primary | |||
Transcript (2) | ||||||
Species | Caenorhabditis elegans | |||||
Interaction | WBInteraction000008526 | |||||
Reference | WBPaper00030828 | |||||
Phenotype | WBPhenotype:0000195 | Remark | RNAi treatment did not reduce the extent of distal tip cell (DTC) migration in vab-3(e1796)animals. In vab-3(e1796) the DTC does not stop migration, authors call this perpetual DTC migration. | |||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
Method | RNAi |