WormBase Tree Display for RNAi: WBRNAi00069107
expand all nodes | collapse all nodes | view schema
| WBRNAi00069107 | Homol | Homol_homol | F36A4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ttccacgtggtgacgctaagatcgtgcttccgtgtaatctgcagcgtctcatttggaatgctcagaaaatattcaaagttgatctgcgcaagccggtgaatctctcgccgttgcacgtgatctccggagtccgtgagctttcgaaaaagctgatcattgtcagtggaaacgacgagatttcaaagcaggctcagtacaatgcgacacttttgatgaatatcttgctccgttcgacactttgcaccaagaacatgtgcacaaaatcaaaactgaactctgaagcgttcgattggctcctcggagaaattgaatcgcgattccaacaggctattgctcaaccgggagagatggttggagcattggcggctcaatcgctcggagagccagctactcagatgacactcaacacgttccattatgcaggagtttcggcgaagaatgtgacacttggagtgccgagattgaaggagattatcaatgtttcgaagacgttgaagactccgtcgttgactgtattcttgacgggagcggctgccaaggatccggaaaaggcgaaggatgtgttgtgcaag | |||
| Experiment | Laboratory | JJ | |||
| Date | 17 Oct 2001 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F36A4.7 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000123 | Inferred_automatically | RNAi_primary | ||
| Transcript | F36A4.7.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005115 | ||||
| Phenotype | WBPhenotype:0001408 | Remark | PAR-3 and PAR-2 switch from anterior-posterior to apical-basal polarity | ||
| Phenotype_not_observed | WBPhenotype:0000362 | Remark | a blastocoel appeared to form normally in ama-1(RNAi) embryos | ||
| Method | RNAi |
