WormBase Tree Display for RNAi: WBRNAi00063089
expand all nodes | collapse all nodes | view schema
| WBRNAi00063089 | Homol | Homol_homol | K01G5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gcttcaagtccatagctggcttactctttttagtcttctttggcgcttctgtcgatacttttttcaacttgagagatcctttgacgactgtgtctttcattgttctgaatatgaaaattgtgaaccagtgtctaccttctatcgagcttttgcaagatattttaatgattgaaacataatgagaacactggaaaaaagtttaaattaatcatcgttcattcgagtcataaaaatattgggagtgggcgaaagaaaagatcattgtacaggaaattacgaaacggggcaggataatttagtgattgatacacagattattgctcagactcgtatgtctcc | |||
| Experiment | Laboratory | EU | |||
| Date | 09 Feb 2004 00:00:00 | ||||
| Genotype | tba-1(or346ts) | ||||
| Temperature | 26 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | K01G5.8a | Inferred_automatically | RNAi_primary | |
| K01G5.8b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00006536 | Inferred_automatically | RNAi_primary | ||
| WBGene00010479 | Inferred_automatically | RNAi_primary | |||
| Transcript | K01G5.7.1 | Inferred_automatically | RNAi_primary | ||
| K01G5.8b.1 | Inferred_automatically | RNAi_primary | |||
| K01G5.8a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00013420 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | fully penetrant | ||
| Penetrance | Range | 100 | |||
| WBPhenotype:0001681 | Remark | does not rescue of the spindle orientation defect seen in tba-1(or346ts) | |||
| Method | RNAi |
