WormBase Tree Display for RNAi: WBRNAi00005000
expand all nodes | collapse all nodes | view schema
WBRNAi00005000 | History_name | [cgc4735]:hcp-4 | ||
---|---|---|---|---|
Homol | Homol_homol | T03F1:RNAi | ||
Sequence_info | DNA_text | cgtcgcccacttcttgcattctgtctttgttgcttcttttcctgcgccaaagcccttttgttggccttatctttcagctctcgctcggttgctgttctgacgtcagcagttctgtaatagcacaaacgcggatccttgatgacaacggccgtcacaccagtcaatcgcttgcagccactaatcggcgaattgacataaaccggttgttctccaagccacgaacgaacaggcttcacgcggacacgcgtcgatcttcggacaccgtctggagcatcttctggcttc | [cgc4735]:hcp-4 | |
Sequence | [cgc4735]:hcp-4 | |||
Experiment | Laboratory | AR | ||
Date | 11 Jun 2001 00:00:00 | |||
Delivered_by | Soaking | |||
Inhibits (3) | ||||
Species | Caenorhabditis elegans | |||
Reference | WBPaper00004735 | |||
Phenotype | WBPhenotype:0000050 | Remark | chromosomes fail to segregate at anaphase | |
defective association of HCP-1 to centromere | ||||
defective chromosome attachments to the spindle | ||||
possible defects in sister centromere resolution | ||||
Method | RNAi |