WormBase Tree Display for RNAi: WBRNAi00001456
expand all nodes | collapse all nodes | view schema
WBRNAi00001456 | History_name | SA:yk312g1 | |||
---|---|---|---|---|---|
Homol | Homol_homol | F23H12:RNAi | |||
Sequence_info | DNA_text | ttgcaacacattatggaaactgacggtaggctcaaagcctacaaatttgtggcctatgccgctgtgggtttctctattgccgccgtcgcttcagttcttttgacccttccaatggtctattcgtacgtgtcgcacgtcagacagcagatgcaccacgaaatcaacttctgcaaggtaatatttattttaattaatttcttacatatttttttattgcaaattttgatgttgatatatgttcttttgtataatatttatatcttttattatttctagggatctgctaaggacatctttgctgaggtcaactacatgaaggccaacgctggaccagttccaccacgcaaccgtaccacccgtcaagcctacggaggaccagaagtcaacccagctccaaatctccaatgcgagggatgctgccttccaggaccaccaggaccagctggagccccaggaaagccaggaaagccag | yk312g1 | ||
Sequence | yk312g1 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits (3) | |||||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000054 | Remark | %penetrance | ||
Penetrance | Range | 95 | |||
WBPhenotype:0000583 | |||||
Remark | yk312g1 | ||||
sqt-3 | |||||
early larval Dpy lethal (95%) | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |