WormBase Tree Display for RNAi: WBRNAi00001091
expand all nodes | collapse all nodes | view schema
WBRNAi00001091 | History_name | SA:yk279g2 | |||
---|---|---|---|---|---|
Homol | Homol_homol | C24G6:RNAi | |||
Sequence_info | DNA_text | ggaccccaagatgaccgggtaattgaagtcttcttattggttcactaaaaatattgaatctttagagagtcagcttcgcatctccagtgtcttcttcacagaaaacagctgcagtaactgtggcggcccaaactaaacaacctgcaaaagcgaaaaatcttcgaactatgcattccacgccgaagaaatcgaaacctgctcatgatgtggccgatataatttcagtatgatccaatgttattcagaaaataaatcaattaaaatttatttcagcttgtgagtaagcaaagcgacatattggatgacgtttctgaaattgaacacaaaatgatcaagcaggcgaaaatgacacaagatctgacaatggagctggcaaattcaatcgaacgtatcgca | yk279g2 | ||
Sequence | yk279g2 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | C24G6.1 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00006376 | Inferred_automatically | RNAi_primary | ||
Transcript | C24G6.1.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000050 | Remark | %penetrance | ||
Penetrance | Range | 66 | |||
Remark | yk279g2 | ||||
(24hr-) embryonic lethal (66%) | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |