WormBase Tree Display for RNAi: WBRNAi00001084
expand all nodes | collapse all nodes | view schema
WBRNAi00001084 | History_name | SA:yk279b12 | |||
---|---|---|---|---|---|
Homol | Homol_homol | Y111B2A:RNAi | |||
Sequence_info | DNA_text | ttcataatttttcacttctaaacaaaccgaaaaagatggcgttaatatccggcaccgcagtgccaatcgacatcgaatcaaacgacgagaatagtgatgcctgtaaaattacaacactcaaattactaacccgcttcagacgtgtgccacgtgtaaaagtcaaagttcggatcggaaagcggcgccttgacaacacccgatggcccaattgctcccggtgagacacgtagtgatgacattgaattcgcatgcttgcgaggtacacggaagattattaccggaggttttgggatcggagg | yk279b12 | ||
Sequence | yk279b12 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | Y111B2A.8c | Inferred_automatically | RNAi_primary | |
Y111B2A.8g | Inferred_automatically | RNAi_primary | |||
Y111B2A.8e | Inferred_automatically | RNAi_primary | |||
Y111B2A.8f | Inferred_automatically | RNAi_primary | |||
Y111B2A.8d | Inferred_automatically | RNAi_primary | |||
Y111B2A.8a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00013732 | Inferred_automatically | RNAi_primary | ||
Transcript | Y111B2A.8d.1 | Inferred_automatically | RNAi_primary | ||
Y111B2A.8f.1 | Inferred_automatically | RNAi_primary | |||
Y111B2A.8c.1 | Inferred_automatically | RNAi_primary | |||
Y111B2A.8e.1 | Inferred_automatically | RNAi_primary | |||
Y111B2A.8g.1 | Inferred_automatically | RNAi_primary | |||
Y111B2A.8a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk279b12 | ||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |