WormBase Tree Display for RNAi: WBRNAi00000779
expand all nodes | collapse all nodes | view schema
WBRNAi00000779 | History_name | SA:yk245b10 | |||
---|---|---|---|---|---|
Homol | Homol_homol | F35G12:RNAi | |||
Sequence_info | DNA_text | ccactttgagaaaaaaaagaagaatagacatgtcaataatataaataaatttctgaagtgtaataattagcttctgttggaattattatatttaagaaaacaatgaaaatggggcggggggcaatcacaaccacagtataaaaatatcacaacgtcttaatgattttatttgggaaagggtagagctaatatttgaataatatatatttgtgaatcttgaactcgtgagaagttatttttgaggagactgttgaaccggcttcgcagccgatgtattctgaatatatcgatgtttgtatt | yk245b10 | ||
Sequence | yk245b10 | ||||
Experiment | Laboratory (2) | ||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | F10F2.1a | Inferred_automatically | RNAi_primary | |
F10F2.1b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004760 | Inferred_automatically | RNAi_primary | ||
Transcript | F10F2.1a.1 | Inferred_automatically | RNAi_primary | ||
F10F2.1b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk245b10 | ||||
F35G12,no ORF name is assigned | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |