WormBase Tree Display for RNAi: WBRNAi00000496
expand all nodes | collapse all nodes | view schema
| WBRNAi00000496 | History_name | SA:yk206g2 | ||
|---|---|---|---|---|
| Homol | Homol_homol | Y48G1BL:RNAi | ||
| Sequence_info | DNA_text | aaatttatccaataaataaacggaatatatcgatgatatggcaagtagggggaaacggacgggaaaatgattatttacagaaagggcgcgcaccagaggtttctcgggggagccccgaggcgggtggcggagcttggctcaaaatctgtcggaaaaatgggtgaaatgagagaagaggtaacctagaaaatgagatgagaaattcggaagttttgggaaaaaaaaatcaacttttgaacaattcaattgaaaaatc | yk206g2 | |
| Sequence | yk206g2 | |||
| Experiment | Laboratory | SA | ||
| YK | ||||
| Date | 06 Feb 2001 00:00:00 | |||
| Species | Caenorhabditis elegans | |||
| Reference | WBPaper00004651 | |||
| Phenotype_not_observed | WBPhenotype:0000050 | |||
| WBPhenotype:0000062 | ||||
| WBPhenotype:0000535 | ||||
| WBPhenotype:0000689 | ||||
| WBPhenotype:0000886 | ||||
| Remark | yk206g2 | |||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | ||||
| Method | RNAi |
