General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| mv_AAC15230 | SMap | S_parent | Canonical_parent | F25H8 |
|---|---|---|---|---|
| Mapping_primers | Left_mapping_primer | TGACGAATAGTCATACTCACAACGGAAACC | ||
| Right_mapping_primer | TCTGAACGTTATAATAAAAATATAAAATTC | |||
| Species | Caenorhabditis elegans | |||
| Overlaps_CDS | F25H8.7 | |||
| Overlaps_transcript | F25H8.3a.1 | |||
| F25H8.3a.2 | ||||
| F25H8.7.1 | ||||
| Oligo | mv_AAC15230_b | |||
| mv_AAC15230_f | ||||
| Assay_conditions | Orfeome_protocol | |||
| Amplified | 0 | |||
| Method | Orfeome |
