General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| WBPaper00038381:ZK637_1_1 | SMap | S_parent | Canonical_parent | ZK637 |
|---|---|---|---|---|
| Overlaps_CDS | ZK637.8a | |||
| ZK637.8b | ||||
| ZK637.8c | ||||
| ZK637.8d | ||||
| ZK637.8e | ||||
| ZK637.8f | ||||
| Overlaps_transcript | ZK637.8a.1 | |||
| ZK637.8b.1 | ||||
| ZK637.8c.1 | ||||
| ZK637.8d.1 | ||||
| ZK637.8e.1 | ||||
| ZK637.8f.1 | ||||
| Oligo | WBPaper00038381:ATCACCGAACATCACAGCAA | |||
| WBPaper00038381:CGAACAAGCGAGATTGATGA | ||||
| RNAi | WBRNAi00085456 | |||
| Method | GenePairs |
