WormBase Tree Display for Oligo: sjj_ZC47.4_f
expand all nodes | collapse all nodes | view schema
| sjj_ZC47.4_f | Sequence | TCAAATTTAGATTTCCCGTTTGA |
|---|---|---|
| Length | 23 | |
| PCR_product | sjj_ZC47.4 |
Questions, Feedback & Help
-
About
General
People
Want to know more about worm research?
-
Directory
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
-
Tools
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
-
Downloads
Get Started
Tools
Commonly requested data
Need help?
-
Community
External links
-
Support
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
-
Citing WormBase
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
WormBase is supported by grant #U24 HG002223 from the National Human Genome Research Institute
at the US National Institutes of Health, the UK Medical Research Council and the UK Biotechnology and Biological Sciences Research Council.
In 2022, WormBase was named a Core Member of the Global Biodata Coalition.
at the US National Institutes of Health, the UK Medical Research Council and the UK Biotechnology and Biological Sciences Research Council.
In 2022, WormBase was named a Core Member of the Global Biodata Coalition.