WormBase Tree Display for Oligo: cenix:309-f4_T7
expand all nodes | collapse all nodes | view schema
cenix:309-f4_T7 | Sequence | TCAAGGTCAGTAACCCCCTG |
---|---|---|
Length | 20 | |
PCR_product | cenix:309-f4 |
General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
cenix:309-f4_T7 | Sequence | TCAAGGTCAGTAACCCCCTG |
---|---|---|
Length | 20 | |
PCR_product | cenix:309-f4 |