WormBase Tree Display for Feature: WBsf982352
expand all nodes | collapse all nodes | view schema
| WBsf982352 | SMap | S_parent | Sequence | EGAP2 |
|---|---|---|---|---|
| Name | Public_name | pJM412 | ||
| Sequence_details | Flanking_sequences | taaagaattggacactcatcagtggcatga | aagacattactacaatttctccggcatgct | |
| Mapping_target | EGAP2 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is the 'pJM412' enhancer region for pho-1. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00024976 | ||
| Associations | Associated_with_gene | WBGene00004020 | ||
| Associated_with_Interaction | WBInteraction000538685 | |||
| Remark | No detectable activity is produced by a construct (pJM412) in which all three WGATAR sites have been removed by deleting 120 to 189 bp upstream of the pho-1 ATG. [2017-05-31 gw3] | |||
| Method | enhancer |
