General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| WBsf980673 | SMap | S_parent | Sequence | F29F11 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | acgttgaaaccacatgaaaaatgtatgttt | aactatgtataatgcatttaacagaccgtc | |
| Mapping_target | F29F11 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | polyA_site | ||
| SO_term | SO:0000553 | |||
| Defined_by | Defined_by_sequence | elegans_PE_SS_GG5385|c0_g1_i1 | ||
| Associations | Associated_with_transcript | F29F11.5a.1 | ||
| Method | polyA_site |
