WormBase Tree Display for Feature: WBsf978838
expand all nodes | collapse all nodes | view schema
| WBsf978838 | SMap | S_parent | Sequence | R07B7 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gatcactttccattatgcagttcatccatt | tcagaggaatcaaatagttttcttcctgat | |
| Mapping_target | R07B7 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of R07B7.13. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00011097 | ||
| Associated_with_Interaction | WBInteraction000530755 | |||
| WBInteraction000530756 | ||||
| WBInteraction000530757 | ||||
| WBInteraction000530758 | ||||
| WBInteraction000530759 | ||||
| WBInteraction000530760 | ||||
| WBInteraction000530761 | ||||
| Remark | [150922 gw3] This is a region upstream of R07B7.13 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
