WormBase Tree Display for Feature: WBsf978001
expand all nodes | collapse all nodes | view schema
| WBsf978001 | SMap | S_parent | Sequence | F12B6 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tgccgaaaataagaatttccggcaaatcgg | agtcggcaaactgccggaattaaaaatttc | |
| Mapping_target | F12B6 | |||
| DNA_text | tgccgaaaataagaatttccggcaaatcggAAAATTGTACGCATCCTATGAATGTTCCTACATCTATTTTAAAagtcggcaaactgccggaattaaaaatttc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible reference sequence error. Type of change: Insertion. Proposed new sequence: AAAATTGTACGCATCCTATGAATGTTCCTACATCTATTTTAAA Number of supporting reads: 1 Validated by PCR. | ||
| Defined_by | Defined_by_paper | WBPaper00046880 | ||
| Remark | [150714 gw3] This is a set of possible reference sequence errors from the Zhao paper from the Supplementary Data table: Insertion-PCR-NGS-validation-S8. | Paper_evidence | WBPaper00046880 | |
| Method | Genome_sequence_error |
