WormBase Tree Display for Feature: WBsf977721
expand all nodes | collapse all nodes | view schema
WBsf977721 | SMap | S_parent | Sequence | C34C12 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tctcctgacgtggattgcttcgagtgtcga | agctgaacaagcggagcaagatgtggctcc | |
Mapping_target | C34C12 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Highly Occupied Target (HOT) region bound by many transcription factors. | ||
Defined_by | Defined_by_paper | WBPaper00045011 | ||
Defined_by_analysis | modENCODE_HOT_WBPaper00045011 | |||
Score | 75 | |||
Associations | Associated_with_transcription_factor | WBTranscriptionFactor001155 | ||
Bound_by_product_of (74) | ||||
Remark | [141104 gw3] This is reanalysis of the HOT regions in the modENCODE data using updated data. The previous dataset has an Analysis of 'modENCODE_HOT'. | Paper_evidence | WBPaper00045011 | |
Method | binding_site_region |