WormBase Tree Display for Feature: WBsf974762
expand all nodes | collapse all nodes | view schema
| WBsf974762 | SMap | S_parent | Sequence | E03E2 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ctcacaattttcctttcatttttctctcag | tttcagaatcaacattcaataaaacttgga | ||
| Mapping_target | E03E2 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | SL1 trans-splice leader acceptor site | |||
| SO_term | SO:0000706 | ||||
| Defined_by | Defined_by_sequence | elegans_PE_SS_GG248|c1_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | |
| Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 | 1 | |||
| RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 | 1 | ||||
| RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 | 1 | ||||
| RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 2 | ||||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000041.Male.WBbt:0007833.SRP016006.SRX191950 | 1 | ||||
| Associations | Associated_with_CDS | W01C8.6 | |||
| Associated_with_transcript | W01C8.6.1 | ||||
| Remark | Defined by RNASeq data (example read: SRR124275.22080449.+.SL1 - 68M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR016684.14496877.+.SL1 - 28M) from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR124273.3797252.+.SL1 - 68M) from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR493077.33598909.+.SL1 - 68M) from RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR316929.13496555.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 2 reads | |||||
| Defined by RNASeq data (example read: SRR016687.2172997.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR474827.5061360.+.SL1 - 89M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR493076.62817146.+.SL1 - 69M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR504324.9150683.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 1 reads | |||||
| Defined by RNASeq data (example read: SRR580386.9778844.+.SL1 - 27M) from RNASeq.elegans.N2.WBls:0000041.Male.WBbt:0007833.SRP016006.SRX191950 with 1 reads | |||||
| Method | SL1 |
