WormBase Tree Display for Feature: WBsf974136
expand all nodes | collapse all nodes | view schema
| WBsf974136 | SMap | S_parent | Sequence | C12D12 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | atacaaaatcagtaactacagatttttcag | tgttgcttgtttacacgctccaattgaaag | |
| Mapping_target | C12D12 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 | 1 | |
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX145443 | 2 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 | 3 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR089786.10487599.+.SL1 - 70M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 1 reads | |||
| Defined by RNASeq data (example read: SRR493075.48015796.+.SL1 - 58M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX145443 with 2 reads | ||||
| Defined by RNASeq data (example read: SRR493079.2220297.+.SL1 - 63M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031115.31097729.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 3 reads | ||||
| Defined by RNASeq data (example read: SRR031120.28693168.+.SL1 - 30M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR473298.1925749.+.SL1 - 70M1D24M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 1 reads | ||||
| Method | SL1 |
