WormBase Tree Display for Feature: WBsf972455
expand all nodes | collapse all nodes | view schema
WBsf972455 | SMap | S_parent | Sequence | K08H2 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | attttctctctgaaataaatattattgcag | tgcccgaccaacaactccgattctttcgag | |
Mapping_target | K08H2 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 | 1 | |
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 1 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR554453.39035113.+.SL1 + 92M2S) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 1 reads | |||
Defined by RNASeq data (example read: SRR316929.22401455.+.SL1 + 92M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 1 reads | ||||
Defined by RNASeq data (example read: SRR016677.7874661.+.SL1 + 30M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 1 reads | ||||
Method | SL1 |