WormBase Tree Display for Feature: WBsf971820
expand all nodes | collapse all nodes | view schema
WBsf971820 | SMap | S_parent | Sequence | F47B10 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ataaaaatcataaacaatacaacatttaag | atgtctgtaaaattagatgatctcactggt | |
Mapping_target | F47B10 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 | 3 | |
RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 | 2 | |||
Remark | Defined by RNASeq data (example read: SRR493077.134495901.+.SL1 + 69M) from RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 with 3 reads | |||
Defined by RNASeq data (example read: SRR137926.7140132.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 with 2 reads | ||||
Method | SL1 |