WormBase Tree Display for Feature: WBsf970441
expand all nodes | collapse all nodes | view schema
WBsf970441 | SMap | S_parent | Sequence | ZK1055 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ttcagctttttaaaaattagttttgttcag | atacatttacgaccagcttggaaaatcaag | |
Mapping_target | ZK1055 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 1 | |
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 2 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 | 1 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 | 1 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049270 | 3 | |||
RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR089797.1932449.+.SL1 + 68M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 1 reads | |||
Defined by RNASeq data (example read: SRR089796.17657225.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 2 reads | ||||
Defined by RNASeq data (example read: SRR016678.116248.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 1 reads | ||||
Defined by RNASeq data (example read: SRR124256.6643196.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 1 reads | ||||
Defined by RNASeq data (example read: SRR136599.8786737.+.SL1 + 22M5S) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049270 with 3 reads | ||||
Defined by RNASeq data (example read: SRR136597.8047685.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 1 reads | ||||
Method | SL1 |