WormBase Tree Display for Feature: WBsf969995
expand all nodes | collapse all nodes | view schema
WBsf969995 | SMap | S_parent | Sequence | Y58A7A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | aatttgtttttgttcattgtcttatttcag | cgaaaccatggatcattctcagcatcatca | |
Mapping_target | Y58A7A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 | 1 | |
RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR493079.93023519.+.SL2 - 13M817N52M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 1 reads | |||
Defined by RNASeq data (example read: SRR136597.9873302.+.SL2f - 27M) from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 1 reads | ||||
Method | SL2 |