WormBase Tree Display for Feature: WBsf966974
expand all nodes | collapse all nodes | view schema
| WBsf966974 | SMap | S_parent | Sequence | F35E12 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ggcggaaaaataacggtgttagtctttcag | gtacaccagatggaaaacatcatagagtgc | |
| Mapping_target | F35E12 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 | 2 | |
| RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 | 2 | |||
| RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 | 2 | |||
| RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047787 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR016685.12634195.+.SL1 + 28M) from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 with 2 reads | |||
| Defined by RNASeq data (example read: SRR089799.12936902.+.SL1 + 54M14S) from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 2 reads | ||||
| Defined by RNASeq data (example read: SRR137925.6892042.+.SL1 + 67M) from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 with 2 reads | ||||
| Defined by RNASeq data (example read: SRR137926.3498159.+.SL1 + 54M16S) from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR125481.22141596.+.SL1 + 70M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047787 with 1 reads | ||||
| Method | SL1 |
