WormBase Tree Display for Feature: WBsf955719
expand all nodes | collapse all nodes | view schema
WBsf955719 | SMap | S_parent | Sequence | H04D03 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | gtttgcactcactggcaacatcaattccag | catctttcttcaaattctcgaaagtgacac | |
Mapping_target | H04D03 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 1 | |
RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR089796.17878889.+.SL1 - 29M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 1 reads | |||
Defined by RNASeq data (example read: SRR317082.8349718.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 1 reads | ||||
Method | SL1 |