WormBase Tree Display for Feature: WBsf955202
expand all nodes | collapse all nodes | view schema
WBsf955202 | SMap | S_parent | Sequence | T24H10 | |
---|---|---|---|---|---|
Sequence_details | Flanking_sequences | caaactcatgctaaatatttgtattttcag | atgcccttcgtgttatgcaaaccaccaata | ||
Mapping_target | T24H10 | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible | Description | SL1 trans-splice leader acceptor site | |||
SO_term | SO:0000706 | ||||
Defined_by | Defined_by_sequence | EU553922 | Inferred_automatically | make_missing_tsl_features.pl | |
Defined_by_analysis | RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139566 | 1 | |||
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 | 1 | ||||
Remark | Defined by RNASeq data (example read: SRR473085.13221077.+.SL1 + 93M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139566 with 1 reads | ||||
Defined by RNASeq data (example read: SRR493079.116866173.+.SL1 + 63M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 1 reads | |||||
Method | SL1 |