WormBase Tree Display for Feature: WBsf955060
expand all nodes | collapse all nodes | view schema
WBsf955060 | SMap | S_parent | Sequence | C34C6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tatattataatgtattatttatcttttcag | ggaatacgtacgaaatgccttcccatcgac | |
Mapping_target | C34C6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 | 1 | |
RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR027904.5650823.+.SL1 - 28M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 1 reads | |||
Defined by RNASeq data (example read: SRR023579.9962753.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 1 reads | ||||
Defined by RNASeq data (example read: SRR031115.25914092.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 1 reads | ||||
Defined by RNASeq data (example read: SRR031117.459633.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
Method | SL1 |