WormBase Tree Display for Feature: WBsf955058
expand all nodes | collapse all nodes | view schema
WBsf955058 | SMap | S_parent | Sequence | C34C6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | actattaattttttaattaatttttttcag | tgctttcgtttcaacatggggtatctggaa | |
Mapping_target | C34C6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 | 1 | |
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 1 | |||
RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 | 1 | |||
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR027904.1392722.+.SL1 + 30M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 1 reads | |||
Defined by RNASeq data (example read: SRR089795.7050277.+.SL1 + 29M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 1 reads | ||||
Defined by RNASeq data (example read: SRR350977.8595618.+.SL1 + 91M) from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 1 reads | ||||
Defined by RNASeq data (example read: SRR089821.12873426.+.SL1 + 69M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | ||||
Method | SL1 |