WormBase Tree Display for Feature: WBsf952843
expand all nodes | collapse all nodes | view schema
WBsf952843 | SMap | S_parent | Sequence | F42G2 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tttcaagaccatgcagcaatattctttcag | aagcaaatggttttctacacgtgagagaat | |
Mapping_target | F42G2 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037199 | 1 | |
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 | 5 | |||
Remark | Defined by RNASeq data (example read: SRR089798.3193909.+.SL1 + 68M) from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037199 with 1 reads | |||
Defined by RNASeq data (example read: SRR360128.9047879.+.SL1 + 93M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 with 5 reads | ||||
Method | SL1 |