WormBase Tree Display for Feature: WBsf949940
expand all nodes | collapse all nodes | view schema
WBsf949940 | SMap | S_parent | Sequence | T28B8 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tttcaagttgttcaatttctgctcttctag | atttatgagtacaacaatagaaaaagacaa | |
Mapping_target | T28B8 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 | 1 | |
RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028202 | 1 | |||
RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR068576.6697394.+.SL1 + 16M2S) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 with 1 reads | |||
Defined by RNASeq data (example read: SRR068577.5702441.+.SL1 + 16M4S) from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028202 with 1 reads | ||||
Defined by RNASeq data (example read: SRR006512.53015501.+.SL1 + 18M10S) from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 with 1 reads | ||||
Method | SL1 |