WormBase Tree Display for Feature: WBsf948149
expand all nodes | collapse all nodes | view schema
WBsf948149 | SMap | S_parent | Sequence | F21A9 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ataaatgttaaaataattcaaaaatttaag | attgccgaacagtcaccgaccgccgtgtcg | |
Mapping_target | F21A9 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | |
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR023534.13093905.+.SL2f + 27M) from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | |||
Defined by RNASeq data (example read: SRR006514.8666515.+.SL2f + 21M5S) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 1 reads | ||||
Method | SL2 |